Product Details

SNP ID: rs201749590
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49016151 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGACCCCCACAGTCAGAGGTGCTGC[A/G]GCGGCAGGGTCCACAGCGACAGCTG
Phenotype: MIM: 118860 MIM: 152780 MIM: 604788
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CGB3 PubMed Links

Gene Details

Gene: CGB3
Gene Name: chorionic gonadotropin beta subunit 3

There are no transcripts associated with this gene.

Gene: LHB
Gene Name: luteinizing hormone beta polypeptide

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000894.2		Intron			NP_000885.1
XM_011526975.1		Intron			XP_011525277.1

Gene: LOC101059948
Gene Name: uncharacterized LOC101059948

There are no transcripts associated with this gene.

Gene: MIR6798
Gene Name: microRNA 6798

There are no transcripts associated with this gene.

Gene: RUVBL2
Gene Name: RuvB like AAA ATPase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001321190.1		Intron			NP_001308119.1
NM_001321191.1		Intron			NP_001308120.1
NM_006666.2		Intron			NP_006657.1
XM_011526330.1		Intron			XP_011524632.1

View Full Product Details