Product Details

SNP ID: rs202008767
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:5693307 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTACAGGGACACTCACCGCAATGGT[C/T]TTCTCCTTGATGCCACCAACAGGCA
Phenotype: MIM: 605490
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HSD11B1L PubMed Links

Gene Details

Gene: HSD11B1L
Gene Name: hydroxysteroid 11-beta dehydrogenase 1 like

There are no transcripts associated with this gene.

Gene: LONP1
Gene Name: lon peptidase 1, mitochondrial

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001276479.1	2535	Silent Mutation	AAA,AAG	K834K	NP_001263408.1
NM_001276480.1	2535	Silent Mutation	AAA,AAG	K702K	NP_001263409.1
NM_004793.3	2535	Silent Mutation	AAA,AAG	K898K	NP_004784.2
XM_011528441.2	2535	Intron			XP_011526743.1

Gene: RPL36
Gene Name: ribosomal protein L36

There are no transcripts associated with this gene.

View Full Product Details