Product Details

SNP ID: rs201394061
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:74518511 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GATGATTTGCTCCCTGCTGTAGAAT[C/T]TGCCATTCCTTCCCTTAGCTGGTTC
Phenotype: MIM: 602434 MIM: 610231 MIM: 604240
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AUP1 PubMed Links

Gene Details

Gene: AUP1
Gene Name: ancient ubiquitous protein 1

There are no transcripts associated with this gene.

Gene: DQX1
Gene Name: DEAQ-box RNA dependent ATPase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_133637.2	1542	Missense Mutation			NP_598376.2
XM_011532644.1	1542	Missense Mutation			XP_011530946.1
XM_011532645.1	1542	Missense Mutation			XP_011530947.1
XM_011532646.2	1542	Intron			XP_011530948.1
XM_017003520.1	1542	Missense Mutation			XP_016859009.1

Gene: PCGF1
Gene Name: polycomb group ring finger 1

There are no transcripts associated with this gene.

Gene: TLX2
Gene Name: T-cell leukemia homeobox 2

There are no transcripts associated with this gene.

View Full Product Details