Product Details

SNP ID: rs200591173
Assay Type: Functionally Tested
NCBI dbSNP Submissions: NA
Location: Chr.2:17816760 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGGCCAGCAGTGGGGGCAGCGAAG[C/G]CTGCAGTGTCGGTGGGGCCAGTGGC
Phenotype: MIM: 612209
Polymorphism: C/G, Transversion Substitution
Allele Nomenclature
Literature Links: MSGN1 PubMed Links
Additional Information: For this assay, SNP(s) [rs34069439] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001105569.1	242	Missense Mutation	GCC,GGC	A81G	NP_001099039.1