Product Details

SNP ID: rs201227095
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:69055465 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGAAGTAAAATGAAGTTTGAATAGT[A/G]CAGTCTGTGGGGTGGTGACATCAGC
Phenotype: MIM: 601126 MIM: 603172
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR3136 PubMed Links

Gene Details

Gene: MIR3136
Gene Name: microRNA 3136

There are no transcripts associated with this gene.

Gene: TMF1
Gene Name: TATA element modulatory factor 1

There are no transcripts associated with this gene.

Gene: UBA3
Gene Name: ubiquitin like modifier activating enzyme 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003968.3	1298	Missense Mutation	GCA,GTA	A455V	NP_003959.3
NM_198195.1	1298	Missense Mutation	GCA,GTA	A441V	NP_937838.1
XM_011534210.1	1298	Missense Mutation	GCA,GTA	A428V	XP_011532512.1
XM_011534211.1	1298	Missense Mutation	GCA,GTA	A414V	XP_011532513.1

View Full Product Details