Product Details

SNP ID: rs200580073
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:173333617 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGAAGAAGGCGTACGAGGACATTTT[A/G]CCCCGCGGCTTGTTGGGGTCTCCTT
Phenotype: MIM: 605005 MIM: 163906
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: GALNT7 PubMed Links

Gene Details

Gene: GALNT7
Gene Name: polypeptide N-acetylgalactosaminyltransferase 7

There are no transcripts associated with this gene.

Gene: HMGB2
Gene Name: high mobility group box 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130688.1	166	Silent Mutation	GGC,GGT	G11G	NP_001124160.1
NM_001130689.1	166	Silent Mutation	GGC,GGT	G11G	NP_001124161.1
NM_002129.3	166	Silent Mutation	GGC,GGT	G11G	NP_002120.1

Gene: LOC105377538
Gene Name: uncharacterized LOC105377538

There are no transcripts associated with this gene.

View Full Product Details