Product Details

SNP ID: rs199721352
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:173333130 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTTCTTATCACCTTTGGGAGGAA[C/T]GTAATTTTTCATCTCCCTGTCATAG
Phenotype: MIM: 605005 MIM: 163906
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: GALNT7 PubMed Links

Gene Details

Gene: GALNT7
Gene Name: polypeptide N-acetylgalactosaminyltransferase 7

There are no transcripts associated with this gene.

Gene: HMGB2
Gene Name: high mobility group box 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130688.1	368	Missense Mutation	ATT,GTT	I79V	NP_001124160.1
NM_001130689.1	368	Missense Mutation	ATT,GTT	I79V	NP_001124161.1
NM_002129.3	368	Missense Mutation	ATT,GTT	I79V	NP_002120.1

Gene: LOC105377538
Gene Name: uncharacterized LOC105377538

There are no transcripts associated with this gene.

View Full Product Details