Product Details

SNP ID: rs201506772
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:183319581 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TTAGTGTTTCAGGTTGGTGTTTCTC[C/G]TCTCCAGTTCTTGATGATGATCTTG
Phenotype
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: CLDN22 PubMed Links

Gene Details

Gene: CLDN22
Gene Name: claudin 22

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111319.1	1194	Missense Mutation	ACG,AGG	T213R	NP_001104789.1

Gene: CLDN24
Gene Name: claudin 24

There are no transcripts associated with this gene.

Gene: WWC2
Gene Name: WW and C2 domain containing 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_024949.5	1194	UTR 3			NP_079225.5
XM_011532269.2	1194	Intron			XP_011530571.1

View Full Product Details