Product Details

SNP ID: rs200412707
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:27873233 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAGCCATACAGGGTGCGGCCCTGG[C/T]GCTTGAGCGCGTAAACCACGTCCAT
Phenotype: MIM: 142711 MIM: 602793 MIM: 602814 MIM: 602831
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: HIST1H1B PubMed Links

Gene Details

Gene: HIST1H1B
Gene Name: histone cluster 1, H1b

There are no transcripts associated with this gene.

Gene: HIST1H2AL
Gene Name: histone cluster 1, H2al

There are no transcripts associated with this gene.

Gene: HIST1H3I
Gene Name: histone cluster 1, H3i

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003533.2	279	Intron			NP_003524.1

Gene: HIST1H4L
Gene Name: histone cluster 1, H4l

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003546.2	279	Missense Mutation	CAC,CGC	H93R	NP_003537.1

View Full Product Details