Product Details

SNP ID: rs200433470
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144467217 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTCCTTCGCAGTCTGGCGAGGTCCC[C/T]TCACTGTTGACAGTGACCAGTCAGC
Phenotype: MIM: 616635 MIM: 603621 MIM: 615216
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CYHR1 PubMed Links

Gene Details

Gene: CYHR1
Gene Name: cysteine and histidine rich 1

There are no transcripts associated with this gene.

Gene: FOXH1
Gene Name: forkhead box H1

There are no transcripts associated with this gene.

Gene: KIFC2
Gene Name: kinesin family member C2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_145754.3	428	Silent Mutation	CCC,CCT	P115P	NP_665697.1
XM_005272357.3	428	Silent Mutation	CCC,CCT	P115P	XP_005272414.1
XM_011517362.2	428	Silent Mutation	CCC,CCT	P115P	XP_011515664.1

View Full Product Details