Product Details

SNP ID
rs12929360
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.16:57622607 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
AGGCATGTGATTGGGTGAGGGAAGG[A/G]CTTATTAGAGGTGGCTCAGCCTTGC
Phenotype
MIM: 604110
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
ADGRG1 PubMed Links
Additional Information
For this assay, SNP(s) [rs115672562] are located under a probe and SNP(s) [rs138541794] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
ADGRG1
Gene Name
adhesion G protein-coupled receptor G1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001145770.2 Intron NP_001139242.1
NM_001145771.2 Intron NP_001139243.1
NM_001145772.2 Intron NP_001139244.1
NM_001145773.2 Intron NP_001139245.1
NM_001145774.2 Intron NP_001139246.1
NM_001290142.1 Intron NP_001277071.1
NM_001290143.1 Intron NP_001277072.1
NM_001290144.1 Intron NP_001277073.1
NM_005682.6 Intron NP_005673.3
NM_201524.3 Intron NP_958932.1
NM_201525.3 Intron NP_958933.1
XM_005256237.2 Intron XP_005256294.1
XM_005256238.2 Intron XP_005256295.1
XM_005256239.2 Intron XP_005256296.1
XM_005256240.4 Intron XP_005256297.1
XM_005256241.4 Intron XP_005256298.1
XM_005256242.4 Intron XP_005256299.1
XM_005256244.3 Intron XP_005256301.1
XM_005256245.2 Intron XP_005256302.1
XM_005256246.2 Intron XP_005256303.1
XM_005256247.2 Intron XP_005256304.1
XM_005256248.2 Intron XP_005256305.1
XM_005256249.3 Intron XP_005256306.1
XM_005256251.4 Intron XP_005256308.1
XM_005256252.2 Intron XP_005256309.1
XM_005256254.2 Intron XP_005256311.1
XM_005256255.2 Intron XP_005256312.1
XM_006721338.2 Intron XP_006721401.1
XM_006721339.3 Intron XP_006721402.1
XM_006721340.3 Intron XP_006721403.1
XM_006721341.2 Intron XP_006721404.1
XM_006721342.2 Intron XP_006721405.1
XM_006721343.3 Intron XP_006721406.1
XM_006721344.2 Intron XP_006721407.1
XM_006721345.3 Intron XP_006721408.1
XM_006721346.2 Intron XP_006721409.1
XM_006721347.2 Intron XP_006721410.1
XM_011523461.2 Intron XP_011521763.1
XM_011523462.2 Intron XP_011521764.1
XM_011523463.2 Intron XP_011521765.1
XM_011523464.2 Intron XP_011521766.1
XM_011523465.2 Intron XP_011521767.1
XM_011523466.2 Intron XP_011521768.1
XM_011523467.2 Intron XP_011521769.1
XM_011523468.2 Intron XP_011521770.1
XM_017023892.1 Intron XP_016879381.1

View Full Product Details