Product Details

SNP ID: rs2272295
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.19:47475414 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: GTCTGGGAAGAGTGGGTGCATGGGT[A/G]CTTAAGAGGCTGCATTCTCAGCAGG
Phenotype: MIM: 615620 MIM: 601901
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: KPTN PubMed Links

Gene Details

Gene: KPTN
Gene Name: kaptin, actin binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001291296.1	1249	UTR 3			NP_001278225.1
NM_007059.3	1249	UTR 3			NP_008990.2
XM_011526399.2	1249	UTR 3			XP_011524701.1
XM_017026226.1	1249	UTR 3			XP_016881715.1
XM_017026227.1	1249	UTR 3			XP_016881716.1
XM_017026228.1	1249	UTR 3			XP_016881717.1
XM_017026229.1	1249	Intron			XP_016881718.1

Gene: NAPA-AS1
Gene Name: NAPA antisense RNA 1

There are no transcripts associated with this gene.

Gene: SLC8A2
Gene Name: solute carrier family 8 member A2

There are no transcripts associated with this gene.

View Full Product Details