Product Details

SNP ID: rs12668337
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:100585068 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GTTGGACAGATCCTGCGGGTGGAGG[C/T]GTGGAAGGACAGTCTCTAGCTGGCC
Phenotype: MIM: 609097
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FBXO24 PubMed Links

Gene Details

Gene: FBXO24
Gene Name: F-box protein 24

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001163499.1		Intron			NP_001156971.1
NM_012172.4		Intron			NP_036304.2
NM_033506.2		Intron			NP_277041.1
XM_005250259.3		Intron			XP_005250316.1
XM_011516022.1		Intron			XP_011514324.1
XM_011516023.2		Intron			XP_011514325.1
XM_017011961.1		Intron			XP_016867450.1

Gene: LRCH4
Gene Name: leucine rich repeats and calponin homology domain containing 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001289934.1		Intron			NP_001276863.1
NM_002319.4		Intron			NP_002310.2

Gene: PCOLCE-AS1
Gene Name: PCOLCE antisense RNA 1

There are no transcripts associated with this gene.

View Full Product Details