Product Details
- SNP ID
-
rs603061
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.11:61250856 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- AACTCCTTCCTAGCAGCTGAATTCT[A/C]CCTAAGCCCCTTAGCACCGATGCTG
- Phenotype
-
MIM: 169730
MIM: 611115
- Polymorphism
- A/C, Transversion Substitution
- Allele Nomenclature
-
- Literature Links
-
PGA5
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112919342,rs373710810] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- PGA5
- Gene Name
- pepsinogen 5, group I (pepsinogen A)
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_014224.4 |
|
Intron |
|
|
NP_055039.1 |
- Gene
- VWCE
- Gene Name
- von Willebrand factor C and EGF domains
There are no transcripts associated with this gene.
View Full Product Details