Product Details

SNP ID: rs17875661
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:42272088 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CCATCCCAAATTGCTTATAGAGTTA[A/G]CACGACATCAGTATGAGCTGGTCAC
Phenotype: MIM: 603258
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IKBKB PubMed Links

Gene Details

Gene: IKBKB
Gene Name: inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase beta

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001190720.2	152	Intron			NP_001177649.1
NM_001242778.1	152	UTR 5			NP_001229707.1
NM_001556.2	152	UTR 5			NP_001547.1
XM_005273490.2	152	UTR 5			XP_005273547.1
XM_005273491.4	152	UTR 5			XP_005273548.1
XM_005273492.3	152	UTR 5			XP_005273549.1
XM_005273493.3	152	UTR 5			XP_005273550.1
XM_005273494.2	152	UTR 5			XP_005273551.1
XM_005273495.2	152	UTR 5			XP_005273552.1
XM_005273496.3	152	UTR 5			XP_005273553.1
XM_005273498.3	152	UTR 5			XP_005273555.1
XM_011544517.2	152	UTR 5			XP_011542819.1
XM_011544518.2	152	UTR 5			XP_011542820.1
XM_011544519.2	152	UTR 5			XP_011542821.1
XM_011544520.2	152	Missense Mutation	ACA,GCA	T6A	XP_011542822.1
XM_011544521.2	152	UTR 5			XP_011542823.1
XM_011544522.2	152	UTR 5			XP_011542824.1
XM_017013396.1	152	UTR 5			XP_016868885.1

Gene: LOC101929897
Gene Name: uncharacterized LOC101929897

There are no transcripts associated with this gene.

View Full Product Details