Product Details

SNP ID: rs2302261
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64224789 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTCCCATCTCGTCTCGCACTTGTCC[C/G]CTCACCCCGACCTGCAGGGAATGGC
Phenotype: MIM: 604189 MIM: 607901 MIM: 610470 MIM: 601398
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: DNAJC4 PubMed Links

Gene Details

Gene: DNAJC4
Gene Name: DnaJ heat shock protein family (Hsp40) member C4

There are no transcripts associated with this gene.

Gene: FERMT3
Gene Name: fermitin family member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_031471.5		Intron			NP_113659.3
NM_178443.2		Intron			NP_848537.1
XM_011545294.2		Intron			XP_011543596.1
XM_011545295.2		Intron			XP_011543597.1
XM_017018398.1		Intron			XP_016873887.1
XM_017018399.1		Intron			XP_016873888.1

Gene: NUDT22
Gene Name: nudix hydrolase 22

There are no transcripts associated with this gene.

Gene: TRPT1
Gene Name: tRNA phosphotransferase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001033678.3		Intron			NP_001028850.2
NM_001160389.1		Intron			NP_001153861.1
NM_001160390.1		Intron			NP_001153862.1
NM_001160392.1		Intron			NP_001153864.1
NM_001160393.1		Intron			NP_001153865.1
NM_031472.3		Intron			NP_113660.1
XM_005274345.4		Intron			XP_005274402.1
XM_005274346.4		Intron			XP_005274403.1
XM_005274347.4		Intron			XP_005274404.1
XM_006718706.3		Intron			XP_006718769.1
XM_006718707.3		Intron			XP_006718770.1
XM_017018400.1		Intron			XP_016873889.1
XM_017018401.1		Intron			XP_016873890.1

Gene: VEGFB
Gene Name: vascular endothelial growth factor B

There are no transcripts associated with this gene.

View Full Product Details