Product Details

SNP ID: rs2746024
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:18260834 on Build GRCh38
Set Membership: Validated
Context Sequence [VIC/FAM]: ATCGGGGGCGTGGCCCGCGATCACC[T/G]CTGGGGAAGGCGGGGAGGGGACCTT
Phenotype: MIM: 600362 MIM: 615498 MIM: 601243
Polymorphism: T/G, Transversion substitution
Allele Nomenclature
Literature Links: FLII PubMed Links

Gene Details

Gene: FLII
Gene Name: FLII, actin remodeling protein

There are no transcripts associated with this gene.

Gene: MIEF2
Gene Name: mitochondrial elongation factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144900.1		Intron			NP_001138372.1
NM_139162.3		Intron			NP_631901.2
NM_148886.1		Intron			NP_683684.2
XM_017024190.1		Intron			XP_016879679.1

Gene: TOP3A
Gene Name: topoisomerase (DNA) III alpha

There are no transcripts associated with this gene.

View Full Product Details