Product Details

SNP ID: rs2233043
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:2250287 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGAATCTGAGAACAGACCGTGGGC[A/G]GCTATGCTGACCAGGGCTCCGGATG
Phenotype: MIM: 613430 MIM: 610887
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HAUS3 PubMed Links

Gene Details

Gene: HAUS3
Gene Name: HAUS augmin like complex subunit 3

There are no transcripts associated with this gene.

Gene: MIR4800
Gene Name: microRNA 4800

There are no transcripts associated with this gene.

Gene: MXD4
Gene Name: MAX dimerization protein 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006454.2	919	UTR 3			NP_006445.1
XM_011513388.2	919	UTR 3			XP_011511690.1
XM_017007655.1	919	Intron			XP_016863144.1
XM_017007656.1	919	Intron			XP_016863145.1

Gene: POLN
Gene Name: DNA polymerase nu

There are no transcripts associated with this gene.

View Full Product Details