Product Details

SNP ID
rs2270527
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.9:14735076 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
GGTATTGAAGTTTGGGGAGAAAAGC[G/T]GGGTACATTCAGGTCCTTCTTGACG
Phenotype
MIM: 608944
Polymorphism
G/T, Transversion Substitution
Allele Nomenclature
Literature Links
FREM1 PubMed Links
Additional Information
For this assay, SNP(s) [rs117358199] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
FREM1
Gene Name
FRAS1 related extracellular matrix 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001177704.1 8136 UTR 3 NP_001171175.1
NM_144966.5 8136 UTR 3 NP_659403.4
XM_005251382.3 8136 UTR 3 XP_005251439.1
XM_005251384.4 8136 UTR 3 XP_005251441.1
XM_006716729.3 8136 UTR 3 XP_006716792.1
XM_011517758.2 8136 UTR 3 XP_011516060.1
XM_017014316.1 8136 UTR 3 XP_016869805.1
XM_017014317.1 8136 UTR 3 XP_016869806.1
XM_017014318.1 8136 UTR 3 XP_016869807.1
XM_017014319.1 8136 UTR 3 XP_016869808.1
XM_017014320.1 8136 UTR 3 XP_016869809.1
XM_017014321.1 8136 UTR 3 XP_016869810.1
XM_017014322.1 8136 UTR 3 XP_016869811.1
XM_017014323.1 8136 UTR 3 XP_016869812.1
XM_017014324.1 8136 UTR 3 XP_016869813.1
XM_017014325.1 8136 UTR 3 XP_016869814.1
XM_017014326.1 8136 UTR 3 XP_016869815.1
XM_017014327.1 8136 UTR 3 XP_016869816.1
XM_017014328.1 8136 Intron XP_016869817.1
XM_017014329.1 8136 Intron XP_016869818.1
XM_017014330.1 8136 Intron XP_016869819.1

View Full Product Details