Product Details

SNP ID: rs2353005
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:49869505 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAAAAGCGGACGGTGACTATGTAGA[A/G]ACTGGTCAAGCCCTTTACAGGATTT
Phenotype: MIM: 610221 MIM: 605610 MIM: 610195 MIM: 616659
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: AKT1S1 PubMed Links

Gene Details

Gene: AKT1S1
Gene Name: AKT1 substrate 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001098632.2	1566	UTR 3			NP_001092102.1
NM_001098633.3	1566	UTR 3			NP_001092103.1
NM_001278159.1	1566	UTR 3			NP_001265088.1
NM_001278160.1	1566	UTR 3			NP_001265089.1
NM_032375.5	1566	UTR 3			NP_115751.3

Gene: PNKP
Gene Name: polynucleotide kinase 3'-phosphatase

There are no transcripts associated with this gene.

Gene: PTOV1
Gene Name: prostate tumor overexpressed 1

There are no transcripts associated with this gene.

Gene: TBC1D17
Gene Name: TBC1 domain family member 17

There are no transcripts associated with this gene.

View Full Product Details