Product Details

SNP ID: rs2857465
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.22:29331897 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AGTGGCGCGTGGACCTGGAGGGGGG[C/T]GGCGGGGGCCAGGCCAAAGCTGGGG
Phenotype: MIM: 600157
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: AP1B1 PubMed Links

Gene Details

Gene: AP1B1
Gene Name: adaptor related protein complex 1 beta 1 subunit

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001127.3	2495	Missense Mutation	ACC,GCC	T777A	NP_001118.3
NM_001166019.1	2495	Missense Mutation	ACC,GCC	T750A	NP_001159491.1
NM_145730.2	2495	Missense Mutation	ACC,GCC	T770A	NP_663782.2

Gene: MIR3653
Gene Name: microRNA 3653

There are no transcripts associated with this gene.

Gene: SNORD125
Gene Name: small nucleolar RNA, C/D box 125

There are no transcripts associated with this gene.

View Full Product Details