Product Details

SNP ID: rs2298455
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.11:71999432 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: TGGGGGTGGCATGGGGGTAGATTAG[A/C]GATCCCAGTCTGGTATCCTCTGGAG
Phenotype: MIM: 604113 MIM: 164009
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: IL18BP PubMed Links

Gene Details

Gene: IL18BP
Gene Name: interleukin 18 binding protein

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001039659.1	316	Intron			NP_001034748.1
NM_001039660.1	316	Intron			NP_001034749.1
NM_001145055.1	316	Intron			NP_001138527.1
NM_001145057.1	316	Intron			NP_001138529.1
NM_005699.3	316	UTR 5			NP_005690.2
NM_173042.2	316	UTR 5			NP_766630.2
NM_173044.2	316	Intron			NP_766632.2
XM_017017059.1	316	UTR 5			XP_016872548.1
XM_017017060.1	316	UTR 5			XP_016872549.1
XM_017017061.1	316	UTR 5			XP_016872550.1
XM_017017062.1	316	UTR 5			XP_016872551.1
XM_017017063.1	316	Intron			XP_016872552.1

Gene: NUMA1
Gene Name: nuclear mitotic apparatus protein 1

There are no transcripts associated with this gene.

Gene: RNF121
Gene Name: ring finger protein 121

There are no transcripts associated with this gene.

View Full Product Details