Product Details

SNP ID: rs2305901
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:113158931 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGGAGCGGGCACCCCGGCCGAAGGC[A/G]CCCTGCTGCAGCTCCTGGACGCGGC
Phenotype: MIM: 611665
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CFAP73 PubMed Links

Gene Details

Gene: CFAP73
Gene Name: cilia and flagella associated protein 73

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001144872.1	1169	UTR 3			NP_001138344.1
XM_011538327.2	1169	Intron			XP_011536629.1

Gene: DDX54
Gene Name: DEAD-box helicase 54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001111322.1	1169	Silent Mutation	GGC,GGT	G865G	NP_001104792.1
NM_024072.3	1169	Silent Mutation	GGC,GGT	G864G	NP_076977.3

Gene: MIR7106
Gene Name: microRNA 7106

There are no transcripts associated with this gene.

View Full Product Details