Product Details

SNP ID: rs7250200
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:55387846 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGGGCCCACGCTGCTCAGCTTCTCA[A/G]TGTGAGACTGTCCACACCTGCGAGG
Phenotype: MIM: 603638
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6805 PubMed Links

Gene Details

Gene: MIR6805
Gene Name: microRNA 6805

There are no transcripts associated with this gene.

Gene: RPL28
Gene Name: ribosomal protein L28

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000991.4		Intron			NP_000982.2
NM_001136134.1		Intron			NP_001129606.1
NM_001136135.1		Intron			NP_001129607.1
NM_001136136.1		Intron			NP_001129608.1
NM_001136137.1		Intron			NP_001129609.1

Gene: TMEM190
Gene Name: transmembrane protein 190

There are no transcripts associated with this gene.

Gene: TMEM238
Gene Name: transmembrane protein 238

There are no transcripts associated with this gene.

View Full Product Details