Product Details

SNP ID: rs114630860
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:109444177 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTTCTTTGTGGGAACGAAAGCAGA[C/T]GGCCCACCCTCGTCTAGCCCTGGGC
Phenotype: MIM: 607129 MIM: 603498
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: MICAL1 PubMed Links

Gene Details

Gene: MICAL1
Gene Name: microtubule associated monooxygenase, calponin and LIM domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001159291.1	3566	UTR 3			NP_001152763.1
NM_001286613.1	3566	UTR 3			NP_001273542.1
NM_022765.3	3566	UTR 3			NP_073602.3

Gene: PPIL6
Gene Name: peptidylprolyl isomerase like 6

There are no transcripts associated with this gene.

Gene: SMPD2
Gene Name: sphingomyelin phosphodiesterase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003080.2	3566	Intron			NP_003071.2
XM_005267109.1	3566	Intron			XP_005267166.1
XM_011536079.1	3566	Intron			XP_011534381.1

View Full Product Details