Product Details

SNP ID

rs34413582

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.12:51063914 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CATTTTCAGGCTCCTCAGGGTTACA[A/G]TCTTCGGGCAATAGAGCTTCTAGGG

Phenotype

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

CSRNP2 PubMed Links

Additional Information

For this assay, SNP(s) [rs140038570] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

CSRNP2

Gene Name

cysteine and serine rich nuclear protein 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_030809.2	1691	Silent Mutation	GAC,GAT	D488D	NP_110436.1
XM_006719621.2	1691	Silent Mutation	GAC,GAT	D488D	XP_006719684.1
XM_017019991.1	1691	Silent Mutation	GAC,GAT	D249D	XP_016875480.1

Gene

LETMD1

Gene Name

LETM1 domain containing 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001243689.1	1691	Intron			NP_001230618.1
NM_001300765.1	1691	Intron			NP_001287694.1
NM_015416.4	1691	Intron			NP_056231.3
XM_006719335.1	1691	Intron			XP_006719398.1
XM_006719336.1	1691	Intron			XP_006719399.1
XM_006719339.1	1691	Intron			XP_006719402.1
XM_006719340.1	1691	Intron			XP_006719403.1
XM_011538161.2	1691	Intron			XP_011536463.1
XM_011538162.2	1691	Intron			XP_011536464.1
XM_011538163.2	1691	Intron			XP_011536465.1
XM_011538164.2	1691	Intron			XP_011536466.1
XM_011538165.2	1691	Intron			XP_011536467.1
XM_011538167.1	1691	Intron			XP_011536469.1
XM_017019151.1	1691	Intron			XP_016874640.1
XM_017019152.1	1691	Intron			XP_016874641.1
XM_017019153.1	1691	Intron			XP_016874642.1
XM_017019154.1	1691	Intron			XP_016874643.1
XM_017019155.1	1691	Intron			XP_016874644.1
XM_017019156.1	1691	Intron			XP_016874645.1
XM_017019157.1	1691	Intron			XP_016874646.1
XM_017019158.1	1691	Intron			XP_016874647.1
XM_017019159.1	1691	Intron			XP_016874648.1
XM_017019160.1	1691	Intron			XP_016874649.1
XM_017019161.1	1691	Intron			XP_016874650.1
XM_017019162.1	1691	Intron			XP_016874651.1
XM_017019163.1	1691	Intron			XP_016874652.1
XM_017019164.1	1691	Intron			XP_016874653.1
XM_017019165.1	1691	Intron			XP_016874654.1
XM_017019166.1	1691	Intron			XP_016874655.1
XM_017019167.1	1691	Intron			XP_016874656.1
XM_017019168.1	1691	Intron			XP_016874657.1

View Full Product Details