Product Details

SNP ID: rs35968184
Assay Type: Functionally tested
NCBI dbSNP Submissions: 25
Location: Chr.1:44785602 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGGGAGGGGAGAGGCAGTTACTTG[A/G]GTGTAGACGAGGGGGATGCTGATCC
Phenotype: MIM: 607336 MIM: 600357
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BEST4 PubMed Links

Gene Details

Gene: BEST4
Gene Name: bestrophin 4

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_153274.2	760	Silent Mutation	ACC,ACT	T237T	NP_695006.1
XM_017001020.1	760	Silent Mutation	ACC,ACT	T237T	XP_016856509.1
XM_017001021.1	760	Silent Mutation	ACC,ACT	T237T	XP_016856510.1
XM_017001022.1	760	Silent Mutation	ACC,ACT	T237T	XP_016856511.1
XM_017001023.1	760	Silent Mutation	ACC,ACT	T237T	XP_016856512.1

Gene: RPS8
Gene Name: ribosomal protein S8

There are no transcripts associated with this gene.

Gene: SNORD38A
Gene Name: small nucleolar RNA, C/D box 38A

There are no transcripts associated with this gene.

Gene: SNORD38B
Gene Name: small nucleolar RNA, C/D box 38B

There are no transcripts associated with this gene.

Gene: SNORD46
Gene Name: small nucleolar RNA, C/D box 46

There are no transcripts associated with this gene.

Gene: SNORD55
Gene Name: small nucleolar RNA, C/D box 55

There are no transcripts associated with this gene.

View Full Product Details