Product Details

SNP ID: rs61740339
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:144051967 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CGGCGCTCGGTCAGCACTGACAGCA[A/G]CGCCTCCTCACGAAAGAGCAGCTCG
Phenotype: MIM: 614243 MIM: 610874
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: MIR6846 PubMed Links

Gene Details

Gene: MIR6846
Gene Name: microRNA 6846

There are no transcripts associated with this gene.

Gene: OPLAH
Gene Name: 5-oxoprolinase (ATP-hydrolysing)

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017570.4	3675	Silent Mutation	CTG,TTG	L1191L	NP_060040.1
XM_011516960.1	3675	Silent Mutation	CTG,TTG	L1287L	XP_011515262.1

Gene: SMPD5
Gene Name: sphingomyelin phosphodiesterase 5

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_017014128.1	3675	Intron			XP_016869617.1

Gene: SPATC1
Gene Name: spermatogenesis and centriole associated 1

There are no transcripts associated with this gene.

View Full Product Details