Product Details

SNP ID: rs36102695
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:30382115 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACCACTGGCCTCTGGCACCTGGCG[G/A]TCCTCATAGAGGTTGGTGAGGAAGA
Phenotype: MIM: 612897
Polymorphism: G/A, Transition substitution
Allele Nomenclature
Literature Links: LOC107983970 PubMed Links

Gene Details

Gene: LOC107983970
Gene Name: uncharacterized LOC107983970

There are no transcripts associated with this gene.

Gene: MYLPF
Gene Name: myosin light chain, phosphorylatable, fast skeletal muscle

There are no transcripts associated with this gene.

Gene: SEPT1
Gene Name: septin 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_052838.4	346	Silent Mutation	GAC,GAT	D100D	NP_443070.5
XM_017022991.1	346	Silent Mutation	GAC,GAT	D100D	XP_016878480.1

Gene: ZNF48
Gene Name: zinc finger protein 48

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001214906.1	346	Intron			NP_001201835.1
NM_001214907.1	346	Intron			NP_001201836.1
NM_001214909.1	346	Intron			NP_001201838.1
NM_001324494.1	346	Intron			NP_001311423.1
NM_152652.2	346	Intron			NP_689865.2

View Full Product Details