Product Details

SNP ID: rs4317244
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:185399752 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CGGAGTCTCGGAAGTGTAGAAAATA[C/G]CAGTGGGAAAAGGAAGTGCTGGTAA
Phenotype: MIM: 611482
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ANKRD37 PubMed Links

Gene Details

Gene: ANKRD37
Gene Name: ankyrin repeat domain 37

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_181726.3	2167	Missense Mutation	ACC,AGC	T152S	NP_859077.1
XM_017008176.1	2167	Missense Mutation	ACC,AGC	T152S	XP_016863665.1

Gene: C4orf47
Gene Name: chromosome 4 open reading frame 47

There are no transcripts associated with this gene.

Gene: LRP2BP
Gene Name: LRP2 binding protein

There are no transcripts associated with this gene.

Gene: UFSP2
Gene Name: UFM1 specific peptidase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018359.3	2167	UTR 3			NP_060829.2

View Full Product Details