Product Details

SNP ID

rs35171431

Assay Type

Functionally tested

NCBI dbSNP Submissions

NA

Location

Chr.17:80421894 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

CTACGTGTCGGGCTTCCTGGCCTTC[C/T]GAGAGGTGCCCTTCTTGCTGGAGCT

Phenotype

Polymorphism

C/T, Transition substitution

Allele Nomenclature

Literature Links

ENDOV PubMed Links

Gene Details

Gene

ENDOV

Gene Name

endonuclease V

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001164637.2	373	Intron			NP_001158109.1
NM_001164638.1	373	Intron			NP_001158110.1
NM_173627.4	373	Nonsense Mutation	CGA,TGA	R99*	NP_775898.2
XM_005257244.3	373	Nonsense Mutation	CGA,TGA	R99*	XP_005257301.1
XM_005257246.3	373	Intron			XP_005257303.1
XM_006721837.3	373	Nonsense Mutation	CGA,TGA	R99*	XP_006721900.1
XM_011524655.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522957.1
XM_011524656.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522958.1
XM_011524657.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522959.1
XM_011524658.2	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522960.1
XM_011524660.1	373	Intron			XP_011522962.1
XM_011524661.2	373	Intron			XP_011522963.1
XM_011524662.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522964.1
XM_011524663.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522965.1
XM_011524664.2	373	Nonsense Mutation	CGA,TGA	R16*	XP_011522966.1
XM_011524666.1	373	Nonsense Mutation	CGA,TGA	R16*	XP_011522968.1
XM_011524667.2	373	Nonsense Mutation	CGA,TGA	R16*	XP_011522969.1
XM_011524669.2	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522971.1
XM_011524670.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522972.1
XM_011524671.2	373	Nonsense Mutation	CGA,TGA	R99*	XP_011522973.1
XM_011524672.1	373	Intron			XP_011522974.1
XM_011524673.1	373	Intron			XP_011522975.1
XM_011524674.1	373	Intron			XP_011522976.1
XM_011524675.1	373	Intron			XP_011522977.1
XM_011524676.1	373	Intron			XP_011522978.1
XM_011524677.1	373	Intron			XP_011522979.1
XM_011524678.2	373	Intron			XP_011522980.1
XM_017024508.1	373	Nonsense Mutation	CGA,TGA	R16*	XP_016879997.1
XM_017024509.1	373	Nonsense Mutation	CGA,TGA	R16*	XP_016879998.1
XM_017024510.1	373	Nonsense Mutation	CGA,TGA	R99*	XP_016879999.1
XM_017024511.1	373	Intron			XP_016880000.1
XM_017024512.1	373	Nonsense Mutation	CGA,TGA	R16*	XP_016880001.1
XM_017024513.1	373	Intron			XP_016880002.1
XM_017024514.1	373	Intron			XP_016880003.1
XM_017024515.1	373	Intron			XP_016880004.1
XM_017024516.1	373	Intron			XP_016880005.1
XM_017024517.1	373	Intron			XP_016880006.1
XM_017024518.1	373	Intron			XP_016880007.1
XM_017024519.1	373	Intron			XP_016880008.1
XM_017024520.1	373	Intron			XP_016880009.1

Gene

LOC100294362

Gene Name

uncharacterized LOC100294362

There are no transcripts associated with this gene.

Gene

MIR4730

Gene Name

microRNA 4730

There are no transcripts associated with this gene.

View Full Product Details