Product Details

SNP ID: rs111495538
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.2:96838010 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCTCATTTTCTAGATGAGGAGTTGT[C/T]TTCTCCATGGTCTTGAACGCCTGCT
Phenotype: MIM: 610736 MIM: 607804
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ANKRD23 PubMed Links

Gene Details

Gene: ANKRD23
Gene Name: ankyrin repeat domain 23

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_144994.7	2486	UTR 3			NP_659431.5

Gene: ANKRD39
Gene Name: ankyrin repeat domain 39

There are no transcripts associated with this gene.

Gene: CNNM3
Gene Name: cyclin and CBS domain divalent metal cation transport mediator 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017623.4	2486	Intron			NP_060093.3
NM_199078.2	2486	Intron			NP_951060.1
XM_011510957.2	2486	Intron			XP_011509259.1
XM_017003800.1	2486	Intron			XP_016859289.1

View Full Product Details