Product Details

SNP ID
rs11109968
Assay Type
Functionally tested
NCBI dbSNP Submissions
NA
Location
Chr.12:99648262 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
TAACACCTCCATGGGGAAGCTGCAG[C/G]GGCAACTGTACAAAGGCGAGTATAC
Phenotype
MIM: 607815
Polymorphism
C/G, Transversion substitution
Allele Nomenclature
Literature Links
ANKS1B PubMed Links

Gene Details

Gene
ANKS1B
Gene Name
ankyrin repeat and sterile alpha motif domain containing 1B
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001204065.1 513 Intron NP_001190994.1
NM_001204066.1 513 Intron NP_001190995.1
NM_001204067.1 513 Intron NP_001190996.1
NM_001204068.1 513 Intron NP_001190997.1
NM_001204069.1 513 Intron NP_001190998.1
NM_001204070.1 513 Intron NP_001190999.1
NM_001204079.1 513 Intron NP_001191008.1
NM_001204080.1 513 Intron NP_001191009.1
NM_001204081.1 513 Intron NP_001191010.1
NM_020140.3 513 Intron NP_064525.1
NM_152788.4 513 Intron NP_690001.3
NM_181670.3 513 Intron NP_858056.2
XM_005269028.4 513 Intron XP_005269085.1
XM_005269029.4 513 Intron XP_005269086.1
XM_005269032.3 513 Intron XP_005269089.1
XM_006719504.3 513 Intron XP_006719567.1
XM_006719505.3 513 Intron XP_006719568.1
XM_006719506.3 513 Intron XP_006719569.1
XM_006719507.3 513 Intron XP_006719570.1
XM_006719508.3 513 Intron XP_006719571.1
XM_006719509.3 513 Intron XP_006719572.1
XM_006719510.3 513 Intron XP_006719573.1
XM_006719512.3 513 Intron XP_006719575.1
XM_006719513.3 513 Intron XP_006719576.1
XM_006719514.3 513 Intron XP_006719577.1
XM_011538571.2 513 Intron XP_011536873.1
XM_017019651.1 513 Intron XP_016875140.1
XM_017019652.1 513 Intron XP_016875141.1
XM_017019653.1 513 Intron XP_016875142.1
XM_017019654.1 513 Intron XP_016875143.1
XM_017019655.1 513 Intron XP_016875144.1
XM_017019656.1 513 Intron XP_016875145.1
XM_017019657.1 513 Intron XP_016875146.1
XM_017019658.1 513 Intron XP_016875147.1
XM_017019659.1 513 Intron XP_016875148.1
XM_017019660.1 513 Intron XP_016875149.1
XM_017019661.1 513 Intron XP_016875150.1
XM_017019662.1 513 Intron XP_016875151.1
XM_017019663.1 513 Intron XP_016875152.1
XM_017019664.1 513 Intron XP_016875153.1
XM_017019665.1 513 Intron XP_016875154.1
Gene
FAM71C
Gene Name
family with sequence similarity 71 member C
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_153364.3 513 Silent Mutation CGG,GGG R30G NP_699195.1

View Full Product Details