Product Details

SNP ID: rs79864431
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:24213960 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGTGGGTAAAATCTCTTCTGTCA[C/T]ACACAGATGAACTTTAATAAATTAC
Phenotype: MIM: 610051 MIM: 603171 MIM: 610711
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHMP4A PubMed Links

Gene Details

Gene: CHMP4A
Gene Name: charged multivesicular body protein 4A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_014169.3	570	Intron			NP_054888.2

Gene: MDP1
Gene Name: magnesium dependent phosphatase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199821.1	570	UTR 3			NP_001186750.1
NM_001199822.1	570	UTR 3			NP_001186751.1
NM_138476.3	570	UTR 3			NP_612485.2

Gene: NEDD8
Gene Name: neural precursor cell expressed, developmentally down-regulated 8

There are no transcripts associated with this gene.

Gene: NEDD8-MDP1
Gene Name: NEDD8-MDP1 readthrough

There are no transcripts associated with this gene.

Gene: TSSK4
Gene Name: testis specific serine kinase 4

There are no transcripts associated with this gene.

View Full Product Details