Product Details

SNP ID: rs5030609
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.6:30328904 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TACTTCTCAGATTCCTTTCTTGTCT[A/G]TTAGAAACGTATGTCAAACGAGGAT
Phenotype: MIM: 605700
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: HCG17 PubMed Links

Gene Details

Gene: HCG17
Gene Name: HLA complex group 17 (non-protein coding)

There are no transcripts associated with this gene.

Gene: HCG18
Gene Name: HLA complex group 18 (non-protein coding)

There are no transcripts associated with this gene.

Gene: TRIM39
Gene Name: tripartite motif containing 39

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_021253.3	482	UTR 5			NP_067076.2
NM_172016.2	482	UTR 5			NP_742013.1

Gene: TRIM39-RPP21
Gene Name: TRIM39-RPP21 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001199119.1	482	Intron			NP_001186048.1

View Full Product Details