Product Details

SNP ID: rs4968210
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:7554035 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AGGTGAGGTTTGTGGCTGGAGACAA[A/G]TGATATACCAGGCAAGCCCTCCGTG
Phenotype: MIM: 612844 MIM: 602695 MIM: 604472
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: SENP3 PubMed Links

Gene Details

Gene: SENP3
Gene Name: SUMO1/sentrin/SMT3 specific peptidase 3

There are no transcripts associated with this gene.

Gene: SENP3-EIF4A1
Gene Name: SENP3-EIF4A1 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TNFSF12
Gene Name: tumor necrosis factor superfamily member 12

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003809.2		Intron			NP_003800.1

Gene: TNFSF12-TNFSF13
Gene Name: TNFSF12-TNFSF13 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172089.3		Intron			NP_742086.1

Gene: TNFSF13
Gene Name: tumor necrosis factor superfamily member 13

There are no transcripts associated with this gene.

View Full Product Details