Product Details

SNP ID: rs4252249
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:117988494 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: CTGAAAGTACCTGCTATGAAGTGGC[A/G]CTCCTGAGGTGAGGAAAAGGGAAGA
Phenotype: MIM: 146933
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: IL10RA PubMed Links
Additional Information: For this assay, SNP(s) [rs4252250] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001558.3	257	Silent Mutation	GCA,GCG	A60A	NP_001549.2