Product Details

SNP ID: rs2286616
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:64271664 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TCATCCTCCGGAGCTCGCGGCCATA[G/T]CGCTGTGCTGCCCAGAGGTTGGGGG
Phenotype: MIM: 603167 MIM: 600230
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: BAD PubMed Links

Gene Details

Gene: BAD
Gene Name: BCL2 associated agonist of cell death

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004322.3	663	Silent Mutation			NP_004313.1
NM_032989.2	663	Silent Mutation			NP_116784.1

Gene: GPR137
Gene Name: G protein-coupled receptor 137

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001170726.1	663	Intron			NP_001164197.1
NM_001170880.1	663	Intron			NP_001164351.1
NM_001170881.1	663	Intron			NP_001164352.1
NM_001177358.1	663	Intron			NP_001170829.1
NM_020155.3	663	Intron			NP_064540.3
XM_005274100.2	663	Intron			XP_005274157.1
XM_005274101.2	663	Intron			XP_005274158.1
XM_005274102.2	663	Intron			XP_005274159.1
XM_005274104.2	663	Intron			XP_005274161.1
XM_011545168.2	663	Intron			XP_011543470.1
XM_011545169.1	663	Intron			XP_011543471.1
XM_011545170.2	663	Intron			XP_011543472.1
XM_011545171.2	663	Intron			XP_011543473.1
XM_011545172.2	663	Intron			XP_011543474.1
XM_017018014.1	663	Intron			XP_016873503.1
XM_017018015.1	663	Intron			XP_016873504.1
XM_017018016.1	663	Intron			XP_016873505.1

Gene: PLCB3
Gene Name: phospholipase C beta 3

There are no transcripts associated with this gene.

View Full Product Details