Product Details
- SNP ID
-
rs1654278
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:20123405 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- ACCTGGGTAAAAGTGCTCTCTGGCA[C/T]TATGGAACAACATTTAGTAAGCTGT
- Phenotype
-
MIM: 603973
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
LOC105372310
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs113056924] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- LOC105372310
- Gene Name
- uncharacterized LOC105372310
There are no transcripts associated with this gene.
- Gene
- ZNF90
- Gene Name
- zinc finger protein 90
| Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
| NM_007138.1 |
|
Intron |
|
|
NP_009069.1 |
View Full Product Details