Product Details

SNP ID: rs3746117
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:3762678 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ACTGACGTCTTCCGGAAACGTGCAC[A/T]TGCAAGCTGCCCGCAATACGTCATG
Phenotype: MIM: 604262 MIM: 611858 MIM: 610362
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: APBA3 PubMed Links

Gene Details

Gene: APBA3
Gene Name: amyloid beta precursor protein binding family A member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004886.3	12	Intron			NP_004877.1
XM_006722950.3	12	Intron			XP_006723013.1
XM_006722951.3	12	Intron			XP_006723014.1

Gene: MRPL54
Gene Name: mitochondrial ribosomal protein L54

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_172251.2	12	UTR 5			NP_758455.1

Gene: RAX2
Gene Name: retina and anterior neural fold homeobox 2

There are no transcripts associated with this gene.

View Full Product Details