Product Details

SNP ID

rs3810060

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.18:3497231 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

TGTGTGACTTTTAATTGCTGCTACA[A/C]GGTAAAGAAAAGGTGTATTCTTTTT

Phenotype

MIM: 605445

Polymorphism

A/C, Transversion Substitution

Allele Nomenclature

Literature Links

DLGAP1 PubMed Links

Additional Information

For this assay, SNP(s) [rs563306109] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DLGAP1

Gene Name

DLG associated protein 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003809.2	4115	UTR 3			NP_001003809.1
NM_001242761.1	4115	Intron			NP_001229690.1
NM_001242762.1	4115	UTR 3			NP_001229691.1
NM_001242763.1	4115	UTR 3			NP_001229692.1
NM_001242764.1	4115	UTR 3			NP_001229693.1
NM_001242765.1	4115	Intron			NP_001229694.1
NM_001242766.1	4115	UTR 3			NP_001229695.1
NM_001308390.1	4115	UTR 3			NP_001295319.1
NM_004746.3	4115	UTR 3			NP_004737.2
XM_005258171.2	4115	UTR 3			XP_005258228.1
XM_005258172.1	4115	UTR 3			XP_005258229.1
XM_005258173.3	4115	UTR 3			XP_005258230.2
XM_005258174.4	4115	UTR 3			XP_005258231.1
XM_006722367.3	4115	UTR 3			XP_006722430.1
XM_011525770.2	4115	Intron			XP_011524072.1
XM_011525771.2	4115	Intron			XP_011524073.1
XM_017026080.1	4115	UTR 3			XP_016881569.1
XM_017026081.1	4115	UTR 3			XP_016881570.1
XM_017026082.1	4115	Intron			XP_016881571.1
XM_017026083.1	4115	UTR 3			XP_016881572.1
XM_017026084.1	4115	Intron			XP_016881573.1
XM_017026085.1	4115	Intron			XP_016881574.1

View Full Product Details