Product Details

SNP ID: rs3932433
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:289553 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGTTAGGACTGGAATTCTAAGGTA[G/C]CAGGAGGGAGAGACACACTCAGGGG
Phenotype: MIM: 614757 MIM: 609650 MIM: 617032
Polymorphism: G/C, Transversion substitution
Allele Nomenclature
Literature Links: IFITM5 PubMed Links

Gene Details

Gene: IFITM5
Gene Name: interferon induced transmembrane protein 5

There are no transcripts associated with this gene.

Gene: NLRP6
Gene Name: NLR family pyrin domain containing 6

There are no transcripts associated with this gene.

Gene: PGGHG
Gene Name: protein-glucosylgalactosylhydroxylysine glucosidase

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_025092.4		Intron			NP_079368.3
XM_011520383.2		Intron			XP_011518685.1
XM_011520384.2		Intron			XP_011518686.1
XM_011520385.2		Intron			XP_011518687.1
XM_011520386.2		Intron			XP_011518688.1
XM_011520387.2		Intron			XP_011518689.1
XM_017018355.1		Intron			XP_016873844.1

View Full Product Details