Product Details

SNP ID: rs4432208
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.14:104725578 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CTTCCTAGAAAGTTCTTCCTGGAAC[A/G]GTGGGGGACCTCCCCCCTTGCTCTC
Phenotype: MIM: 612498 MIM: 610982
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ADSSL1 PubMed Links

Gene Details

Gene: ADSSL1
Gene Name: adenylosuccinate synthase like 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001320424.1		Intron			NP_001307353.1
NM_152328.4		Intron			NP_689541.1
NM_199165.2		Intron			NP_954634.1
XM_006720026.3		Intron			XP_006720089.1
XM_011536412.1		Intron			XP_011534714.1
XM_011536414.2		Intron			XP_011534716.1

Gene: INF2
Gene Name: inverted formin, FH2 and WH2 domain containing

There are no transcripts associated with this gene.

Gene: LOC388022
Gene Name: uncharacterized LOC388022

There are no transcripts associated with this gene.

View Full Product Details