Product Details

SNP ID: rs4789146
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:75139498 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: AAAAATAAAAAAGCACCTATGGAGA[C/T]TAAACAAGCAGCAGTAGGCCTTACT
Phenotype: MIM: 191720
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ARMC7 PubMed Links

Gene Details

Gene: ARMC7
Gene Name: armadillo repeat containing 7

There are no transcripts associated with this gene.

Gene: HN1
Gene Name: hematological and neurological expressed 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001002032.2		Intron			NP_001002032.1
NM_001002033.2		Intron			NP_001002033.1
NM_001288609.1		Intron			NP_001275538.1
NM_001288610.1		Intron			NP_001275539.1
NM_001288611.1		Intron			NP_001275540.1
NM_016185.3		Intron			NP_057269.1

Gene: NT5C
Gene Name: 5', 3'-nucleotidase, cytosolic

There are no transcripts associated with this gene.

View Full Product Details