Product Details

SNP ID: rs5906352
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.X:47195882 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: GAATGTCAGATACACCTCTCCTCTT[A/G]CATGTCCCTATCTATTATTTTTGGT
Phenotype: MIM: 300164 MIM: 300080 MIM: 314370
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: INE1 PubMed Links

Gene Details

Gene: INE1
Gene Name: inactivation escape 1 (non-protein coding)

There are no transcripts associated with this gene.

Gene: RBM10
Gene Name: RNA binding motif protein 10

There are no transcripts associated with this gene.

Gene: UBA1
Gene Name: ubiquitin like modifier activating enzyme 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003334.3	1858	Intron			NP_003325.2
NM_153280.2	1858	Intron			NP_695012.1
XM_005272649.1	1858	Intron			XP_005272706.1
XM_011543954.2	1858	Intron			XP_011542256.1
XM_017029777.1	1858	Intron			XP_016885266.1
XM_017029778.1	1858	UTR 5			XP_016885267.1
XM_017029779.1	1858	UTR 5			XP_016885268.1
XM_017029780.1	1858	Intron			XP_016885269.1
XM_017029781.1	1858	Intron			XP_016885270.1

View Full Product Details