Product Details
- SNP ID
-
rs12939002
- Assay Type
- Functionally Tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.17:2061802 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GCCCCGGGGACCCTCCCCTGCTGGC[C/T]TAGAGAGGGCTGCACTGGGCTTCTG
- Phenotype
-
MIM: 603825
MIM: 610963
- Polymorphism
- C/T, Transition Substitution
- Allele Nomenclature
-
- Literature Links
-
HIC1
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs147171693] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- HIC1
- Gene Name
- hypermethylated in cancer 1
There are no transcripts associated with this gene.
- Gene
- SMG6
- Gene Name
- SMG6, nonsense mediated mRNA decay factor
View Full Product Details