Product Details

SNP ID: rs12139487
Assay Type: Functionally tested
NCBI dbSNP Submissions: 56
Location: Chr.1:11657243 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: ACAACAAAAAACTATACAATAGAGA[C/T]AGTTTATGGCCCACAATTCCTACAA
Phenotype: MIM: 607112 MIM: 609111 MIM: 605647
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FBXO2 PubMed Links

Gene Details

Gene: FBXO2
Gene Name: F-box protein 2

There are no transcripts associated with this gene.

Gene: FBXO44
Gene Name: F-box protein 44

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014765.1		Intron			NP_001014765.1
NM_001304790.1		Intron			NP_001291719.1
NM_001304791.1		Intron			NP_001291720.1
NM_033182.5		Intron			NP_149438.2
NM_183412.2		Intron			NP_904319.1
NM_183413.2		Intron			NP_904320.1
XM_005263535.1		Intron			XP_005263592.1
XM_005263536.4		Intron			XP_005263593.1
XM_005263537.1		Intron			XP_005263594.1
XM_006711043.2		Intron			XP_006711106.1
XM_006711045.2		Intron			XP_006711108.1
XM_011542435.1		Intron			XP_011540737.1
XM_017002842.1		Intron			XP_016858331.1
XM_017002843.1		Intron			XP_016858332.1
XM_017002844.1		Intron			XP_016858333.1

Gene: FBXO6
Gene Name: F-box protein 6

There are no transcripts associated with this gene.

View Full Product Details