Product Details
- SNP ID
-
rs11086029
- Assay Type
- Functionally tested
- NCBI dbSNP Submissions
-
NA
- Location
-
Chr.19:16327850 on Build GRCh38
- Set Membership
-
- Context Sequence [VIC/FAM]
- GTGGCCTCCTCTACGTTGAAAAAAA[A/T]AAAACTACTTACCTCTTCCTGGAAG
- Phenotype
-
MIM: 602016
- Polymorphism
- A/T, Transversion substitution
- Allele Nomenclature
-
- Literature Links
-
KLF2
PubMed Links
- Additional Information
-
For this assay, SNP(s) [rs112320919,rs45492593] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.
Gene Details
- Gene
- KLF2
- Gene Name
- Kruppel like factor 2
Transcript Accession |
SNP Location |
SNP Type |
Codon Change |
Amino Acid Change |
Protein ID |
NM_016270.3 |
1985 |
UTR 3 |
|
|
NP_057354.1 |
View Full Product Details