Product Details

SNP ID: rs11086029
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.19:16327850 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GTGGCCTCCTCTACGTTGAAAAAAA[A/T]AAAACTACTTACCTCTTCCTGGAAG
Phenotype: MIM: 602016
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: KLF2 PubMed Links
Additional Information: For this assay, SNP(s) [rs112320919,rs45492593] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_016270.3	1985	UTR 3			NP_057354.1