Product Details

SNP ID: rs11569367
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:6446013 on Build GRCh38
Set Membership: HapMap
Context Sequence [VIC/FAM]: TGCACAAAAGCCAATTTGAGAAAAT[A/G]AGTATGTATGTAGCCTGTGTTTTTA
Phenotype: MIM: 186711 MIM: 607081
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: CD27 PubMed Links

Gene Details

Gene: CD27
Gene Name: CD27 molecule

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001242.4	424	Intron			NP_001233.1
XM_011521042.2	424	UTR 5			XP_011519344.1
XM_017020232.1	424	Intron			XP_016875721.1
XM_017020233.1	424	UTR 5			XP_016875722.1
XM_017020234.1	424	Intron			XP_016875723.1

Gene: CD27-AS1
Gene Name: CD27 antisense RNA 1

There are no transcripts associated with this gene.

Gene: TAPBPL
Gene Name: TAP binding protein like

There are no transcripts associated with this gene.

View Full Product Details