Product Details

SNP ID

rs12724809

Assay Type

Functionally Tested

NCBI dbSNP Submissions

1

Location

Chr.1:175950599 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

AATAAGTTCTAGCTCAACAGGTTAT[C/T]TTTTACTTGCTAAATAAAATAAAAG

Phenotype

MIM: 608067

Polymorphism

C/T, Transition Substitution

Allele Nomenclature

Literature Links

RFWD2 PubMed Links

Additional Information

For this assay, SNP(s) [rs77357230] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

RFWD2

Gene Name

ring finger and WD repeat domain 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001001740.3		Intron			NP_001001740.1
NM_001286644.1		Intron			NP_001273573.1
NM_022457.6		Intron			NP_071902.2
XM_005245447.2		Intron			XP_005245504.1
XM_005245448.2		Intron			XP_005245505.1
XM_006711487.2		Intron			XP_006711550.1
XM_011509881.1		Intron			XP_011508183.1
XM_017002059.1		Intron			XP_016857548.1
XM_017002060.1		Intron			XP_016857549.1
XM_017002061.1		Intron			XP_016857550.1
XM_017002062.1		Intron			XP_016857551.1
XM_017002063.1		Intron			XP_016857552.1
XM_017002064.1		Intron			XP_016857553.1
XM_017002065.1		Intron			XP_016857554.1
XM_017002066.1		Intron			XP_016857555.1
XM_017002067.1		Intron			XP_016857556.1
XM_017002068.1		Intron			XP_016857557.1
XM_017002069.1		Intron			XP_016857558.1
XM_017002070.1		Intron			XP_016857559.1
XM_017002071.1		Intron			XP_016857560.1
XM_017002072.1		Intron			XP_016857561.1
XM_017002073.1		Intron			XP_016857562.1
XM_017002074.1		Intron			XP_016857563.1
XM_017002075.1		Intron			XP_016857564.1
XM_017002076.1		Intron			XP_016857565.1
XM_017002077.1		Intron			XP_016857566.1
XM_017002078.1		Intron			XP_016857567.1
XM_017002079.1		Intron			XP_016857568.1
XM_017002080.1		Intron			XP_016857569.1

View Full Product Details